Copyright©2018 CSIR-Institute of Genomics and Integrative Biology | VS Lab |
circRNA_15067 | |||
Gene | n/a | Organism | Pigs |
Genome Locus | n/a | Build | n/a |
Disease | Metabolism related diseases | ICD-10 | Metabolic disorders (E70-E90) |
DBLink | Link to database | PMID | 29990990 |
Experimental Method | |||
Sample Type | Tissues | Comparison | Large White pig and Laiwu pig (a local breed) with difference in fat deposition |
Method for Estimation | Quantitative PCR | PCR Details | |
Primers (Experimented) | Forward TTGTGGGGAACTCGGCATTT ReverseCGCAAAGACTGCAAAGCACT | Statistics | Fold Change : Downregulated pvalue : p<0.05 |
Citation | |||
Li, A, Huang, W, Zhang, X, Xie, L, Miao, X (2018). Identification and Characterization of CircRNAs of Two Pig Breeds as a New Biomarker in Metabolism-Related Diseases. Cell. Physiol. Biochem., 47, 6:2458-2470. |